ID: 1141623579

View in Genome Browser
Species Human (GRCh38)
Location 16:85249784-85249806
Sequence CGGCCTGACCCTGTGCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623579_1141623581 -6 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623581 16:85249801-85249823 AGGCCGCCCTGCAGTTTGGCAGG No data
1141623579_1141623587 2 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623587 16:85249809-85249831 CTGCAGTTTGGCAGGTGGGCAGG No data
1141623579_1141623583 -3 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623583 16:85249804-85249826 CCGCCCTGCAGTTTGGCAGGTGG No data
1141623579_1141623588 3 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623588 16:85249810-85249832 TGCAGTTTGGCAGGTGGGCAGGG No data
1141623579_1141623580 -10 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623579_1141623584 -2 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623579 Original CRISPR CGGCCTGACCCTGTGCCACT TGG (reversed) Intergenic
No off target data available for this crispr