ID: 1141623580

View in Genome Browser
Species Human (GRCh38)
Location 16:85249797-85249819
Sequence GGTCAGGCCGCCCTGCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623571_1141623580 8 Left 1141623571 16:85249766-85249788 CCCCTCACAGCTGCGTGCCCAAG No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623573_1141623580 6 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623578_1141623580 -9 Left 1141623578 16:85249783-85249805 CCCAAGTGGCACAGGGTCAGGCC No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623579_1141623580 -10 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623570_1141623580 29 Left 1141623570 16:85249745-85249767 CCTGGCTTGGAGTCGGGGCTGCC No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623572_1141623580 7 Left 1141623572 16:85249767-85249789 CCCTCACAGCTGCGTGCCCAAGT No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623580 Original CRISPR GGTCAGGCCGCCCTGCAGTT TGG Intergenic
No off target data available for this crispr