ID: 1141623584

View in Genome Browser
Species Human (GRCh38)
Location 16:85249805-85249827
Sequence CGCCCTGCAGTTTGGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623578_1141623584 -1 Left 1141623578 16:85249783-85249805 CCCAAGTGGCACAGGGTCAGGCC No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data
1141623579_1141623584 -2 Left 1141623579 16:85249784-85249806 CCAAGTGGCACAGGGTCAGGCCG No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data
1141623571_1141623584 16 Left 1141623571 16:85249766-85249788 CCCCTCACAGCTGCGTGCCCAAG No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data
1141623573_1141623584 14 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data
1141623572_1141623584 15 Left 1141623572 16:85249767-85249789 CCCTCACAGCTGCGTGCCCAAGT No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623584 Original CRISPR CGCCCTGCAGTTTGGCAGGT GGG Intergenic
No off target data available for this crispr