ID: 1141624408

View in Genome Browser
Species Human (GRCh38)
Location 16:85253716-85253738
Sequence GAGGGTGGCAAGAGTGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141624391_1141624408 30 Left 1141624391 16:85253663-85253685 CCGCCCAGCCTCCTTCCTGGAAG No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624400_1141624408 6 Left 1141624400 16:85253687-85253709 CCTGGAGGAAGAGTTAGCCAGGG No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624393_1141624408 26 Left 1141624393 16:85253667-85253689 CCAGCCTCCTTCCTGGAAGACCT No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624392_1141624408 27 Left 1141624392 16:85253666-85253688 CCCAGCCTCCTTCCTGGAAGACC No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624398_1141624408 15 Left 1141624398 16:85253678-85253700 CCTGGAAGACCTGGAGGAAGAGT No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624397_1141624408 19 Left 1141624397 16:85253674-85253696 CCTTCCTGGAAGACCTGGAGGAA No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data
1141624395_1141624408 22 Left 1141624395 16:85253671-85253693 CCTCCTTCCTGGAAGACCTGGAG No data
Right 1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141624408 Original CRISPR GAGGGTGGCAAGAGTGCTCC CGG Intergenic
No off target data available for this crispr