ID: 1141624666

View in Genome Browser
Species Human (GRCh38)
Location 16:85254924-85254946
Sequence TGTTTATGAGCGCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141624666_1141624670 10 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624670 16:85254957-85254979 TCCCCCGGTGATCCCCAGGCTGG No data
1141624666_1141624682 27 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624682 16:85254974-85254996 GGCTGGGGAGAAGAGGTGGTTGG No data
1141624666_1141624672 11 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624672 16:85254958-85254980 CCCCCGGTGATCCCCAGGCTGGG No data
1141624666_1141624683 28 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624683 16:85254975-85254997 GCTGGGGAGAAGAGGTGGTTGGG No data
1141624666_1141624684 29 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624684 16:85254976-85254998 CTGGGGAGAAGAGGTGGTTGGGG No data
1141624666_1141624677 20 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624677 16:85254967-85254989 ATCCCCAGGCTGGGGAGAAGAGG No data
1141624666_1141624669 6 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624669 16:85254953-85254975 TGTGTCCCCCGGTGATCCCCAGG No data
1141624666_1141624685 30 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624685 16:85254977-85254999 TGGGGAGAAGAGGTGGTTGGGGG No data
1141624666_1141624680 23 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624680 16:85254970-85254992 CCCAGGCTGGGGAGAAGAGGTGG No data
1141624666_1141624668 -5 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624668 16:85254942-85254964 AAACACTGTTCTGTGTCCCCCGG No data
1141624666_1141624674 12 Left 1141624666 16:85254924-85254946 CCACCACAGTGCGCTCATAAACA No data
Right 1141624674 16:85254959-85254981 CCCCGGTGATCCCCAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141624666 Original CRISPR TGTTTATGAGCGCACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr