ID: 1141628142

View in Genome Browser
Species Human (GRCh38)
Location 16:85272250-85272272
Sequence CGCATAGCCCTTGCAGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141628142_1141628147 18 Left 1141628142 16:85272250-85272272 CCGTGCTCTGCAAGGGCTATGCG No data
Right 1141628147 16:85272291-85272313 TCCATGTCTGAAGGAGCCTCAGG No data
1141628142_1141628145 9 Left 1141628142 16:85272250-85272272 CCGTGCTCTGCAAGGGCTATGCG No data
Right 1141628145 16:85272282-85272304 ATCCGTTTTTCCATGTCTGAAGG No data
1141628142_1141628149 28 Left 1141628142 16:85272250-85272272 CCGTGCTCTGCAAGGGCTATGCG No data
Right 1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141628142 Original CRISPR CGCATAGCCCTTGCAGAGCA CGG (reversed) Intergenic
No off target data available for this crispr