ID: 1141628146

View in Genome Browser
Species Human (GRCh38)
Location 16:85272284-85272306
Sequence CTCCTTCAGACATGGAAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141628146_1141628153 2 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628153 16:85272309-85272331 TCAGGCCCGCAGAGGTGTCGGGG No data
1141628146_1141628152 1 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628152 16:85272308-85272330 CTCAGGCCCGCAGAGGTGTCGGG No data
1141628146_1141628151 0 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628151 16:85272307-85272329 CCTCAGGCCCGCAGAGGTGTCGG No data
1141628146_1141628149 -6 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG No data
1141628146_1141628156 18 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628156 16:85272325-85272347 GTCGGGGCCTTTGCCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141628146 Original CRISPR CTCCTTCAGACATGGAAAAA CGG (reversed) Intergenic
No off target data available for this crispr