ID: 1141628149

View in Genome Browser
Species Human (GRCh38)
Location 16:85272301-85272323
Sequence AAGGAGCCTCAGGCCCGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141628142_1141628149 28 Left 1141628142 16:85272250-85272272 CCGTGCTCTGCAAGGGCTATGCG No data
Right 1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG No data
1141628146_1141628149 -6 Left 1141628146 16:85272284-85272306 CCGTTTTTCCATGTCTGAAGGAG No data
Right 1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141628149 Original CRISPR AAGGAGCCTCAGGCCCGCAG AGG Intergenic
No off target data available for this crispr