ID: 1141629260

View in Genome Browser
Species Human (GRCh38)
Location 16:85277813-85277835
Sequence GGGTCTGCCACAGGCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141629260_1141629278 27 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629278 16:85277863-85277885 GCTGGGCCTCTGCCTGGGACTGG No data
1141629260_1141629277 22 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629277 16:85277858-85277880 CTGCTGCTGGGCCTCTGCCTGGG No data
1141629260_1141629276 21 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629276 16:85277857-85277879 GCTGCTGCTGGGCCTCTGCCTGG No data
1141629260_1141629272 9 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629272 16:85277845-85277867 CCCAGGACACCAGCTGCTGCTGG No data
1141629260_1141629274 10 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629274 16:85277846-85277868 CCAGGACACCAGCTGCTGCTGGG No data
1141629260_1141629265 -8 Left 1141629260 16:85277813-85277835 CCATCCATGCCTGTGGCAGACCC No data
Right 1141629265 16:85277828-85277850 GCAGACCCCAGGCCGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141629260 Original CRISPR GGGTCTGCCACAGGCATGGA TGG (reversed) Intergenic
No off target data available for this crispr