ID: 1141630787

View in Genome Browser
Species Human (GRCh38)
Location 16:85286953-85286975
Sequence CTTCCACCCTGGAAAGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141630782_1141630787 24 Left 1141630782 16:85286906-85286928 CCGGGTCGGAAGCAGCTCTGGTG No data
Right 1141630787 16:85286953-85286975 CTTCCACCCTGGAAAGCGTCGGG No data
1141630784_1141630787 -8 Left 1141630784 16:85286938-85286960 CCTTTGCAAAATGTGCTTCCACC No data
Right 1141630787 16:85286953-85286975 CTTCCACCCTGGAAAGCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141630787 Original CRISPR CTTCCACCCTGGAAAGCGTC GGG Intergenic
No off target data available for this crispr