ID: 1141631796

View in Genome Browser
Species Human (GRCh38)
Location 16:85291783-85291805
Sequence CCGTGGGGCCCATAACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141631784_1141631796 8 Left 1141631784 16:85291752-85291774 CCAGAGGCCAGAGGCCACCTCCC No data
Right 1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG No data
1141631783_1141631796 9 Left 1141631783 16:85291751-85291773 CCCAGAGGCCAGAGGCCACCTCC No data
Right 1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG No data
1141631787_1141631796 -6 Left 1141631787 16:85291766-85291788 CCACCTCCCAGGCCTCTCCGTGG No data
Right 1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG No data
1141631791_1141631796 -9 Left 1141631791 16:85291769-85291791 CCTCCCAGGCCTCTCCGTGGGGC No data
Right 1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG No data
1141631786_1141631796 1 Left 1141631786 16:85291759-85291781 CCAGAGGCCACCTCCCAGGCCTC No data
Right 1141631796 16:85291783-85291805 CCGTGGGGCCCATAACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141631796 Original CRISPR CCGTGGGGCCCATAACCTCC TGG Intergenic
No off target data available for this crispr