ID: 1141632404

View in Genome Browser
Species Human (GRCh38)
Location 16:85295442-85295464
Sequence GTGGATGGGCAAAAAGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141632404_1141632409 -6 Left 1141632404 16:85295442-85295464 CCGCGTCCTTTTTGCCCATCCAC No data
Right 1141632409 16:85295459-85295481 ATCCACCGCCGATGGCCGTTTGG No data
1141632404_1141632415 12 Left 1141632404 16:85295442-85295464 CCGCGTCCTTTTTGCCCATCCAC No data
Right 1141632415 16:85295477-85295499 TTTGGGCTGTCTCCACCTTTCGG No data
1141632404_1141632410 -5 Left 1141632404 16:85295442-85295464 CCGCGTCCTTTTTGCCCATCCAC No data
Right 1141632410 16:85295460-85295482 TCCACCGCCGATGGCCGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141632404 Original CRISPR GTGGATGGGCAAAAAGGACG CGG (reversed) Intergenic
No off target data available for this crispr