ID: 1141633111

View in Genome Browser
Species Human (GRCh38)
Location 16:85299577-85299599
Sequence CAGAGAACGGAGTAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141633111_1141633115 25 Left 1141633111 16:85299577-85299599 CCCTCTGCCTACTCCGTTCTCTG No data
Right 1141633115 16:85299625-85299647 GACTTAAAAATTGCATTCTTTGG No data
1141633111_1141633116 30 Left 1141633111 16:85299577-85299599 CCCTCTGCCTACTCCGTTCTCTG No data
Right 1141633116 16:85299630-85299652 AAAAATTGCATTCTTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141633111 Original CRISPR CAGAGAACGGAGTAGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr