ID: 1141633901

View in Genome Browser
Species Human (GRCh38)
Location 16:85303717-85303739
Sequence GGCCGCCGCCTCCCGAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141633897_1141633901 1 Left 1141633897 16:85303693-85303715 CCGGGCGCTGGGGCCACAGGCAC No data
Right 1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141633901 Original CRISPR GGCCGCCGCCTCCCGAGTTC TGG Intergenic
No off target data available for this crispr