ID: 1141635377

View in Genome Browser
Species Human (GRCh38)
Location 16:85311489-85311511
Sequence CCTCCCTCCCCAATGTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141635377_1141635384 -10 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635384 16:85311502-85311524 GGGAGGGAGGGAGGGAGGGAAGG 0: 4469
1: 9380
2: 17747
3: 25965
4: 42187
1141635377_1141635390 19 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635390 16:85311531-85311553 CGGGGTGCTCACCTTCCCCGAGG No data
1141635377_1141635387 0 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635387 16:85311512-85311534 GAGGGAGGGAAGGAGGTGCCGGG No data
1141635377_1141635386 -1 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635386 16:85311511-85311533 GGAGGGAGGGAAGGAGGTGCCGG No data
1141635377_1141635388 1 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635388 16:85311513-85311535 AGGGAGGGAAGGAGGTGCCGGGG No data
1141635377_1141635385 -7 Left 1141635377 16:85311489-85311511 CCGTGGGACATTGGGGAGGGAGG No data
Right 1141635385 16:85311505-85311527 AGGGAGGGAGGGAGGGAAGGAGG 0: 374
1: 5970
2: 11936
3: 20987
4: 33312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141635377 Original CRISPR CCTCCCTCCCCAATGTCCCA CGG (reversed) Intergenic
No off target data available for this crispr