ID: 1141642451

View in Genome Browser
Species Human (GRCh38)
Location 16:85349167-85349189
Sequence CCTGATAAGCAGACAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141642451_1141642454 -9 Left 1141642451 16:85349167-85349189 CCTTTAGTTGTCTGCTTATCAGG No data
Right 1141642454 16:85349181-85349203 CTTATCAGGGACTCTGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141642451 Original CRISPR CCTGATAAGCAGACAACTAA AGG (reversed) Intergenic
No off target data available for this crispr