ID: 1141644558

View in Genome Browser
Species Human (GRCh38)
Location 16:85360318-85360340
Sequence CCAGGTCAGCCGTTGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141644558_1141644571 12 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644571 16:85360353-85360375 CCCTGCCCTGCGGCCGGGTGGGG No data
1141644558_1141644565 6 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644565 16:85360347-85360369 AGGAGCCCCTGCCCTGCGGCCGG No data
1141644558_1141644582 27 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644582 16:85360368-85360390 GGGTGGGGGCAGGTGGGGCAGGG No data
1141644558_1141644578 21 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644578 16:85360362-85360384 GCGGCCGGGTGGGGGCAGGTGGG No data
1141644558_1141644579 22 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644579 16:85360363-85360385 CGGCCGGGTGGGGGCAGGTGGGG No data
1141644558_1141644569 11 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644569 16:85360352-85360374 CCCCTGCCCTGCGGCCGGGTGGG No data
1141644558_1141644577 20 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644577 16:85360361-85360383 TGCGGCCGGGTGGGGGCAGGTGG No data
1141644558_1141644566 7 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644566 16:85360348-85360370 GGAGCCCCTGCCCTGCGGCCGGG No data
1141644558_1141644563 2 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644563 16:85360343-85360365 AGCCAGGAGCCCCTGCCCTGCGG No data
1141644558_1141644567 10 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644567 16:85360351-85360373 GCCCCTGCCCTGCGGCCGGGTGG No data
1141644558_1141644581 26 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644581 16:85360367-85360389 CGGGTGGGGGCAGGTGGGGCAGG No data
1141644558_1141644575 17 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644575 16:85360358-85360380 CCCTGCGGCCGGGTGGGGGCAGG No data
1141644558_1141644573 13 Left 1141644558 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG No data
Right 1141644573 16:85360354-85360376 CCTGCCCTGCGGCCGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141644558 Original CRISPR CCAGGTCAGCCGTTGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr