ID: 1141646355

View in Genome Browser
Species Human (GRCh38)
Location 16:85370071-85370093
Sequence ATCCAGCCCCTGCCCCGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141646355_1141646360 -4 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646360 16:85370090-85370112 GGATACTGGCCGGACCCAGGAGG No data
1141646355_1141646361 2 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646361 16:85370096-85370118 TGGCCGGACCCAGGAGGTTCTGG No data
1141646355_1141646367 28 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646355_1141646362 3 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646362 16:85370097-85370119 GGCCGGACCCAGGAGGTTCTGGG No data
1141646355_1141646366 25 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646366 16:85370119-85370141 GTGCAGTTTAGCGTTTTCCCAGG No data
1141646355_1141646359 -7 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646359 16:85370087-85370109 GCTGGATACTGGCCGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141646355 Original CRISPR ATCCAGCCCCTGCCCCGCAA GGG (reversed) Intergenic
No off target data available for this crispr