ID: 1141646356

View in Genome Browser
Species Human (GRCh38)
Location 16:85370072-85370094
Sequence TATCCAGCCCCTGCCCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141646356_1141646359 -8 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646359 16:85370087-85370109 GCTGGATACTGGCCGGACCCAGG No data
1141646356_1141646361 1 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646361 16:85370096-85370118 TGGCCGGACCCAGGAGGTTCTGG No data
1141646356_1141646368 30 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646368 16:85370125-85370147 TTTAGCGTTTTCCCAGGAGGTGG No data
1141646356_1141646360 -5 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646360 16:85370090-85370112 GGATACTGGCCGGACCCAGGAGG No data
1141646356_1141646367 27 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646356_1141646366 24 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646366 16:85370119-85370141 GTGCAGTTTAGCGTTTTCCCAGG No data
1141646356_1141646362 2 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646362 16:85370097-85370119 GGCCGGACCCAGGAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141646356 Original CRISPR TATCCAGCCCCTGCCCCGCA AGG (reversed) Intergenic
No off target data available for this crispr