ID: 1141646365

View in Genome Browser
Species Human (GRCh38)
Location 16:85370105-85370127
Sequence AAACTGCACCCAGAACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141646365_1141646368 -3 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646368 16:85370125-85370147 TTTAGCGTTTTCCCAGGAGGTGG No data
1141646365_1141646366 -9 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646366 16:85370119-85370141 GTGCAGTTTAGCGTTTTCCCAGG No data
1141646365_1141646371 13 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646371 16:85370141-85370163 GAGGTGGCGCAGTGAAGCCCTGG No data
1141646365_1141646367 -6 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141646365 Original CRISPR AAACTGCACCCAGAACCTCC TGG (reversed) Intergenic
No off target data available for this crispr