ID: 1141646367

View in Genome Browser
Species Human (GRCh38)
Location 16:85370122-85370144
Sequence CAGTTTAGCGTTTTCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141646356_1141646367 27 Left 1141646356 16:85370072-85370094 CCTTGCGGGGCAGGGGCTGGATA No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646365_1141646367 -6 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646364_1141646367 -5 Left 1141646364 16:85370104-85370126 CCCAGGAGGTTCTGGGTGCAGTT No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646355_1141646367 28 Left 1141646355 16:85370071-85370093 CCCTTGCGGGGCAGGGGCTGGAT No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data
1141646363_1141646367 0 Left 1141646363 16:85370099-85370121 CCGGACCCAGGAGGTTCTGGGTG No data
Right 1141646367 16:85370122-85370144 CAGTTTAGCGTTTTCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141646367 Original CRISPR CAGTTTAGCGTTTTCCCAGG AGG Intergenic
No off target data available for this crispr