ID: 1141646371

View in Genome Browser
Species Human (GRCh38)
Location 16:85370141-85370163
Sequence GAGGTGGCGCAGTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141646365_1141646371 13 Left 1141646365 16:85370105-85370127 CCAGGAGGTTCTGGGTGCAGTTT No data
Right 1141646371 16:85370141-85370163 GAGGTGGCGCAGTGAAGCCCTGG No data
1141646363_1141646371 19 Left 1141646363 16:85370099-85370121 CCGGACCCAGGAGGTTCTGGGTG No data
Right 1141646371 16:85370141-85370163 GAGGTGGCGCAGTGAAGCCCTGG No data
1141646364_1141646371 14 Left 1141646364 16:85370104-85370126 CCCAGGAGGTTCTGGGTGCAGTT No data
Right 1141646371 16:85370141-85370163 GAGGTGGCGCAGTGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141646371 Original CRISPR GAGGTGGCGCAGTGAAGCCC TGG Intergenic
No off target data available for this crispr