ID: 1141647413

View in Genome Browser
Species Human (GRCh38)
Location 16:85375158-85375180
Sequence CAGCTCGCACAGCCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141647413_1141647421 30 Left 1141647413 16:85375158-85375180 CCCAGCTCAGGCTGTGCGAGCTG No data
Right 1141647421 16:85375211-85375233 TCATTACTAATCCCCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141647413 Original CRISPR CAGCTCGCACAGCCTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr