ID: 1141649650

View in Genome Browser
Species Human (GRCh38)
Location 16:85386076-85386098
Sequence AACCCTGACCTGTCACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649650_1141649660 30 Left 1141649650 16:85386076-85386098 CCTCTCTGTGACAGGTCAGGGTT No data
Right 1141649660 16:85386129-85386151 CCTCCCACCCTGTTTAAATATGG No data
1141649650_1141649654 -10 Left 1141649650 16:85386076-85386098 CCTCTCTGTGACAGGTCAGGGTT No data
Right 1141649654 16:85386089-85386111 GGTCAGGGTTGAGGGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649650 Original CRISPR AACCCTGACCTGTCACAGAG AGG (reversed) Intergenic
No off target data available for this crispr