ID: 1141649806

View in Genome Browser
Species Human (GRCh38)
Location 16:85386867-85386889
Sequence CCCAAGAGGCACCCCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649806_1141649823 28 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649823 16:85386918-85386940 TGGACTTTGGAAGGGACAACTGG No data
1141649806_1141649816 4 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649816 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
1141649806_1141649820 15 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649820 16:85386905-85386927 GGCTTTGGCTGGGTGGACTTTGG No data
1141649806_1141649813 -6 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649813 16:85386884-85386906 CTTGGGGTGGCCCTGGCTGCTGG No data
1141649806_1141649821 19 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649821 16:85386909-85386931 TTGGCTGGGTGGACTTTGGAAGG No data
1141649806_1141649814 0 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649814 16:85386890-85386912 GTGGCCCTGGCTGCTGGCTTTGG No data
1141649806_1141649819 8 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649819 16:85386898-85386920 GGCTGCTGGCTTTGGCTGGGTGG No data
1141649806_1141649818 5 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649818 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
1141649806_1141649822 20 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649806 Original CRISPR CCCAAGAGGCACCCCAGGAA TGG (reversed) Intergenic
No off target data available for this crispr