ID: 1141649810

View in Genome Browser
Species Human (GRCh38)
Location 16:85386872-85386894
Sequence GCCACCCCAAGAGGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649810_1141649821 14 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649821 16:85386909-85386931 TTGGCTGGGTGGACTTTGGAAGG No data
1141649810_1141649816 -1 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649816 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
1141649810_1141649814 -5 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649814 16:85386890-85386912 GTGGCCCTGGCTGCTGGCTTTGG No data
1141649810_1141649819 3 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649819 16:85386898-85386920 GGCTGCTGGCTTTGGCTGGGTGG No data
1141649810_1141649818 0 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649818 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
1141649810_1141649823 23 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649823 16:85386918-85386940 TGGACTTTGGAAGGGACAACTGG No data
1141649810_1141649822 15 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649810_1141649820 10 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649820 16:85386905-85386927 GGCTTTGGCTGGGTGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649810 Original CRISPR GCCACCCCAAGAGGCACCCC AGG (reversed) Intergenic