ID: 1141649812

View in Genome Browser
Species Human (GRCh38)
Location 16:85386881-85386903
Sequence GCAGCCAGGGCCACCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649812_1141649823 14 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649823 16:85386918-85386940 TGGACTTTGGAAGGGACAACTGG No data
1141649812_1141649821 5 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649821 16:85386909-85386931 TTGGCTGGGTGGACTTTGGAAGG No data
1141649812_1141649816 -10 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649816 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
1141649812_1141649819 -6 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649819 16:85386898-85386920 GGCTGCTGGCTTTGGCTGGGTGG No data
1141649812_1141649820 1 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649820 16:85386905-85386927 GGCTTTGGCTGGGTGGACTTTGG No data
1141649812_1141649818 -9 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649818 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
1141649812_1141649822 6 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649812 Original CRISPR GCAGCCAGGGCCACCCCAAG AGG (reversed) Intergenic
No off target data available for this crispr