ID: 1141649814

View in Genome Browser
Species Human (GRCh38)
Location 16:85386890-85386912
Sequence GTGGCCCTGGCTGCTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649806_1141649814 0 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649814 16:85386890-85386912 GTGGCCCTGGCTGCTGGCTTTGG No data
1141649810_1141649814 -5 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649814 16:85386890-85386912 GTGGCCCTGGCTGCTGGCTTTGG No data
1141649804_1141649814 8 Left 1141649804 16:85386859-85386881 CCAGGGTGCCATTCCTGGGGTGC No data
Right 1141649814 16:85386890-85386912 GTGGCCCTGGCTGCTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649814 Original CRISPR GTGGCCCTGGCTGCTGGCTT TGG Intergenic
No off target data available for this crispr