ID: 1141649815

View in Genome Browser
Species Human (GRCh38)
Location 16:85386894-85386916
Sequence CCAGCCAAAGCCAGCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649815_1141649824 18 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649824 16:85386935-85386957 AACTGGACAGCTCCCACTGAAGG No data
1141649815_1141649821 -8 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649821 16:85386909-85386931 TTGGCTGGGTGGACTTTGGAAGG No data
1141649815_1141649825 24 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649825 16:85386941-85386963 ACAGCTCCCACTGAAGGTTCTGG No data
1141649815_1141649822 -7 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649815_1141649823 1 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649823 16:85386918-85386940 TGGACTTTGGAAGGGACAACTGG No data
1141649815_1141649826 25 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649826 16:85386942-85386964 CAGCTCCCACTGAAGGTTCTGGG No data
1141649815_1141649827 26 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649827 16:85386943-85386965 AGCTCCCACTGAAGGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649815 Original CRISPR CCAGCCAAAGCCAGCAGCCA GGG (reversed) Intergenic