ID: 1141649817

View in Genome Browser
Species Human (GRCh38)
Location 16:85386895-85386917
Sequence CCCAGCCAAAGCCAGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649817_1141649824 17 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649824 16:85386935-85386957 AACTGGACAGCTCCCACTGAAGG No data
1141649817_1141649822 -8 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649817_1141649821 -9 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649821 16:85386909-85386931 TTGGCTGGGTGGACTTTGGAAGG No data
1141649817_1141649827 25 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649827 16:85386943-85386965 AGCTCCCACTGAAGGTTCTGGGG No data
1141649817_1141649823 0 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649823 16:85386918-85386940 TGGACTTTGGAAGGGACAACTGG No data
1141649817_1141649826 24 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649826 16:85386942-85386964 CAGCTCCCACTGAAGGTTCTGGG No data
1141649817_1141649825 23 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649825 16:85386941-85386963 ACAGCTCCCACTGAAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649817 Original CRISPR CCCAGCCAAAGCCAGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr