ID: 1141649822

View in Genome Browser
Species Human (GRCh38)
Location 16:85386910-85386932
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649810_1141649822 15 Left 1141649810 16:85386872-85386894 CCTGGGGTGCCTCTTGGGGTGGC No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649815_1141649822 -7 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649812_1141649822 6 Left 1141649812 16:85386881-85386903 CCTCTTGGGGTGGCCCTGGCTGC No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649806_1141649822 20 Left 1141649806 16:85386867-85386889 CCATTCCTGGGGTGCCTCTTGGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649817_1141649822 -8 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data
1141649804_1141649822 28 Left 1141649804 16:85386859-85386881 CCAGGGTGCCATTCCTGGGGTGC No data
Right 1141649822 16:85386910-85386932 TGGCTGGGTGGACTTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649822 Original CRISPR TGGCTGGGTGGACTTTGGAA GGG Intergenic
No off target data available for this crispr