ID: 1141649825

View in Genome Browser
Species Human (GRCh38)
Location 16:85386941-85386963
Sequence ACAGCTCCCACTGAAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141649815_1141649825 24 Left 1141649815 16:85386894-85386916 CCCTGGCTGCTGGCTTTGGCTGG No data
Right 1141649825 16:85386941-85386963 ACAGCTCCCACTGAAGGTTCTGG No data
1141649817_1141649825 23 Left 1141649817 16:85386895-85386917 CCTGGCTGCTGGCTTTGGCTGGG No data
Right 1141649825 16:85386941-85386963 ACAGCTCCCACTGAAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141649825 Original CRISPR ACAGCTCCCACTGAAGGTTC TGG Intergenic
No off target data available for this crispr