ID: 1141651435

View in Genome Browser
Species Human (GRCh38)
Location 16:85395119-85395141
Sequence CTGAGGATGAGGAGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141651428_1141651435 16 Left 1141651428 16:85395080-85395102 CCTAAGCATAGGGAGGTTGTAGG No data
Right 1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141651435 Original CRISPR CTGAGGATGAGGAGGAAGGA TGG Intergenic
No off target data available for this crispr