ID: 1141651778

View in Genome Browser
Species Human (GRCh38)
Location 16:85396717-85396739
Sequence GGGAGGCCACAGGCCCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141651770_1141651778 17 Left 1141651770 16:85396677-85396699 CCACAACGGGGCAGGATGGATGT No data
Right 1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG No data
1141651769_1141651778 18 Left 1141651769 16:85396676-85396698 CCCACAACGGGGCAGGATGGATG No data
Right 1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG No data
1141651774_1141651778 -6 Left 1141651774 16:85396700-85396722 CCGGACGCTACACAAGTGGGAGG No data
Right 1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG No data
1141651768_1141651778 19 Left 1141651768 16:85396675-85396697 CCCCACAACGGGGCAGGATGGAT No data
Right 1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141651778 Original CRISPR GGGAGGCCACAGGCCCCCGT GGG Intergenic
No off target data available for this crispr