ID: 1141651874

View in Genome Browser
Species Human (GRCh38)
Location 16:85397127-85397149
Sequence TCTCCTCTGTGAAGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141651863_1141651874 -5 Left 1141651863 16:85397109-85397131 CCTTGCCCCTGTCCCCCATCTCC No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651858_1141651874 7 Left 1141651858 16:85397097-85397119 CCCAGGGAGCCCCCTTGCCCCTG No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651860_1141651874 -2 Left 1141651860 16:85397106-85397128 CCCCCTTGCCCCTGTCCCCCATC No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651862_1141651874 -4 Left 1141651862 16:85397108-85397130 CCCTTGCCCCTGTCCCCCATCTC No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651857_1141651874 14 Left 1141651857 16:85397090-85397112 CCAATGTCCCAGGGAGCCCCCTT No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651864_1141651874 -10 Left 1141651864 16:85397114-85397136 CCCCTGTCCCCCATCTCCTCTGT No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651859_1141651874 6 Left 1141651859 16:85397098-85397120 CCAGGGAGCCCCCTTGCCCCTGT No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data
1141651861_1141651874 -3 Left 1141651861 16:85397107-85397129 CCCCTTGCCCCTGTCCCCCATCT No data
Right 1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141651874 Original CRISPR TCTCCTCTGTGAAGTCCTGG GGG Intergenic
No off target data available for this crispr