ID: 1141652140

View in Genome Browser
Species Human (GRCh38)
Location 16:85398368-85398390
Sequence CCTCCTGAGCAGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141652125_1141652140 27 Left 1141652125 16:85398318-85398340 CCTGAGGGGTCGCAGAGCTCCCA No data
Right 1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG No data
1141652131_1141652140 7 Left 1141652131 16:85398338-85398360 CCAGGGGTTAGAGCAGGCAAGAG No data
Right 1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG No data
1141652130_1141652140 8 Left 1141652130 16:85398337-85398359 CCCAGGGGTTAGAGCAGGCAAGA No data
Right 1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141652140 Original CRISPR CCTCCTGAGCAGGAGGTGGA GGG Intergenic
No off target data available for this crispr