ID: 1141656836

View in Genome Browser
Species Human (GRCh38)
Location 16:85421199-85421221
Sequence CACCCTCCTGTCTCCTGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141656827_1141656836 26 Left 1141656827 16:85421150-85421172 CCAAGAGAAACAGGAAGGGCAGG No data
Right 1141656836 16:85421199-85421221 CACCCTCCTGTCTCCTGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141656836 Original CRISPR CACCCTCCTGTCTCCTGGAC GGG Intergenic
No off target data available for this crispr