ID: 1141657566

View in Genome Browser
Species Human (GRCh38)
Location 16:85424247-85424269
Sequence CGCTGGCACCGGAGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141657566_1141657575 4 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657575 16:85424274-85424296 GACATCTTACCCAGAAGTCGAGG No data
1141657566_1141657579 18 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657579 16:85424288-85424310 AAGTCGAGGCTTGAGGTTCTTGG No data
1141657566_1141657580 24 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657580 16:85424294-85424316 AGGCTTGAGGTTCTTGGCGACGG No data
1141657566_1141657581 28 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657581 16:85424298-85424320 TTGAGGTTCTTGGCGACGGCAGG No data
1141657566_1141657582 29 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657582 16:85424299-85424321 TGAGGTTCTTGGCGACGGCAGGG No data
1141657566_1141657576 11 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141657566 Original CRISPR CGCTGGCACCGGAGGGGCGG GGG (reversed) Intergenic