ID: 1141657576

View in Genome Browser
Species Human (GRCh38)
Location 16:85424281-85424303
Sequence TACCCAGAAGTCGAGGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141657566_1141657576 11 Left 1141657566 16:85424247-85424269 CCCCCGCCCCTCCGGTGCCAGCG No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657572_1141657576 3 Left 1141657572 16:85424255-85424277 CCTCCGGTGCCAGCGTACAGACA No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657567_1141657576 10 Left 1141657567 16:85424248-85424270 CCCCGCCCCTCCGGTGCCAGCGT No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657568_1141657576 9 Left 1141657568 16:85424249-85424271 CCCGCCCCTCCGGTGCCAGCGTA No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657571_1141657576 4 Left 1141657571 16:85424254-85424276 CCCTCCGGTGCCAGCGTACAGAC No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657573_1141657576 0 Left 1141657573 16:85424258-85424280 CCGGTGCCAGCGTACAGACATCT No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657570_1141657576 5 Left 1141657570 16:85424253-85424275 CCCCTCCGGTGCCAGCGTACAGA No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657569_1141657576 8 Left 1141657569 16:85424250-85424272 CCGCCCCTCCGGTGCCAGCGTAC No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data
1141657574_1141657576 -6 Left 1141657574 16:85424264-85424286 CCAGCGTACAGACATCTTACCCA No data
Right 1141657576 16:85424281-85424303 TACCCAGAAGTCGAGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141657576 Original CRISPR TACCCAGAAGTCGAGGCTTG AGG Intergenic