ID: 1141657747

View in Genome Browser
Species Human (GRCh38)
Location 16:85425078-85425100
Sequence GGGAGGGCCGACCGGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141657747_1141657753 -9 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657753 16:85425092-85425114 GGCCCTCCCTGGGCGCCCTGGGG No data
1141657747_1141657758 -4 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657758 16:85425097-85425119 TCCCTGGGCGCCCTGGGGCGGGG No data
1141657747_1141657752 -10 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657752 16:85425091-85425113 CGGCCCTCCCTGGGCGCCCTGGG No data
1141657747_1141657760 -3 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657760 16:85425098-85425120 CCCTGGGCGCCCTGGGGCGGGGG No data
1141657747_1141657762 -2 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657762 16:85425099-85425121 CCTGGGCGCCCTGGGGCGGGGGG No data
1141657747_1141657767 26 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657767 16:85425127-85425149 CCAGCAGCCACTTGCATCCCTGG No data
1141657747_1141657756 -6 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657756 16:85425095-85425117 CCTCCCTGGGCGCCCTGGGGCGG No data
1141657747_1141657757 -5 Left 1141657747 16:85425078-85425100 CCAGGACTCCGGTCGGCCCTCCC No data
Right 1141657757 16:85425096-85425118 CTCCCTGGGCGCCCTGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141657747 Original CRISPR GGGAGGGCCGACCGGAGTCC TGG (reversed) Intergenic
No off target data available for this crispr