ID: 1141660838

View in Genome Browser
Species Human (GRCh38)
Location 16:85440712-85440734
Sequence TGCCCCCGTGATGGTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141660838_1141660852 20 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660852 16:85440755-85440777 CCGTGGAGGTGGGGCCTTGCTGG No data
1141660838_1141660844 3 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660844 16:85440738-85440760 CGCGGCCTGGAATATGCCCGTGG No data
1141660838_1141660849 11 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660849 16:85440746-85440768 GGAATATGCCCGTGGAGGTGGGG No data
1141660838_1141660847 9 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660847 16:85440744-85440766 CTGGAATATGCCCGTGGAGGTGG No data
1141660838_1141660843 -10 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660843 16:85440725-85440747 CACGGGGGCACAGCGCGGCCTGG No data
1141660838_1141660848 10 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660848 16:85440745-85440767 TGGAATATGCCCGTGGAGGTGGG No data
1141660838_1141660853 21 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660853 16:85440756-85440778 CGTGGAGGTGGGGCCTTGCTGGG No data
1141660838_1141660845 6 Left 1141660838 16:85440712-85440734 CCCCAGGAACCATCACGGGGGCA No data
Right 1141660845 16:85440741-85440763 GGCCTGGAATATGCCCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141660838 Original CRISPR TGCCCCCGTGATGGTTCCTG GGG (reversed) Intergenic
No off target data available for this crispr