ID: 1141661626

View in Genome Browser
Species Human (GRCh38)
Location 16:85444699-85444721
Sequence TTTTCTAGCAACACGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141661626_1141661632 17 Left 1141661626 16:85444699-85444721 CCGGGCTCCGTGTTGCTAGAAAA No data
Right 1141661632 16:85444739-85444761 ACTGAACCAGCATCCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141661626 Original CRISPR TTTTCTAGCAACACGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr