ID: 1141663626

View in Genome Browser
Species Human (GRCh38)
Location 16:85454503-85454525
Sequence CCAGGCTCCTGGGCAGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141663615_1141663626 26 Left 1141663615 16:85454454-85454476 CCACAGTGCCCTTTTGGCTGGGC No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
1141663617_1141663626 17 Left 1141663617 16:85454463-85454485 CCTTTTGGCTGGGCTCATTTTCC No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
1141663619_1141663626 -4 Left 1141663619 16:85454484-85454506 CCCTGGAGCATCCATGCAGCCAG No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
1141663616_1141663626 18 Left 1141663616 16:85454462-85454484 CCCTTTTGGCTGGGCTCATTTTC No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
1141663613_1141663626 27 Left 1141663613 16:85454453-85454475 CCCACAGTGCCCTTTTGGCTGGG No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
1141663620_1141663626 -5 Left 1141663620 16:85454485-85454507 CCTGGAGCATCCATGCAGCCAGG No data
Right 1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141663626 Original CRISPR CCAGGCTCCTGGGCAGATGC CGG Intergenic
No off target data available for this crispr