ID: 1141663635

View in Genome Browser
Species Human (GRCh38)
Location 16:85454546-85454568
Sequence ATAATGAATCACCCTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141663627_1141663635 13 Left 1141663627 16:85454510-85454532 CCTGGGCAGATGCCGGATGAGTT No data
Right 1141663635 16:85454546-85454568 ATAATGAATCACCCTAAACCAGG No data
1141663625_1141663635 20 Left 1141663625 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG No data
Right 1141663635 16:85454546-85454568 ATAATGAATCACCCTAAACCAGG No data
1141663631_1141663635 1 Left 1141663631 16:85454522-85454544 CCGGATGAGTTTCCCGGGGCTGC No data
Right 1141663635 16:85454546-85454568 ATAATGAATCACCCTAAACCAGG No data
1141663624_1141663635 28 Left 1141663624 16:85454495-85454517 CCATGCAGCCAGGCTCCTGGGCA No data
Right 1141663635 16:85454546-85454568 ATAATGAATCACCCTAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141663635 Original CRISPR ATAATGAATCACCCTAAACC AGG Intergenic
No off target data available for this crispr