ID: 1141664452

View in Genome Browser
Species Human (GRCh38)
Location 16:85458644-85458666
Sequence TTCCCAGGACAACCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664452_1141664455 2 Left 1141664452 16:85458644-85458666 CCAAAGTGGGGTTGTCCTGGGAA No data
Right 1141664455 16:85458669-85458691 CATTAGGAATGCAGATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664452 Original CRISPR TTCCCAGGACAACCCCACTT TGG (reversed) Intergenic
No off target data available for this crispr