ID: 1141664865

View in Genome Browser
Species Human (GRCh38)
Location 16:85460818-85460840
Sequence GACTCTCCCCACCCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664865_1141664871 16 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664871 16:85460857-85460879 ACCCAGGGGACCGTGAGAGTGGG No data
1141664865_1141664875 28 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664875 16:85460869-85460891 GTGAGAGTGGGCTGCAAATCAGG No data
1141664865_1141664866 0 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664866 16:85460841-85460863 TGCCAGAGCAGTTCAGACCCAGG No data
1141664865_1141664869 2 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664869 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
1141664865_1141664867 1 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664867 16:85460842-85460864 GCCAGAGCAGTTCAGACCCAGGG No data
1141664865_1141664870 15 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664870 16:85460856-85460878 GACCCAGGGGACCGTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664865 Original CRISPR GACTCTCCCCACCCCCACCC TGG (reversed) Intergenic