ID: 1141664868

View in Genome Browser
Species Human (GRCh38)
Location 16:85460843-85460865
Sequence CCCCTGGGTCTGAACTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664868_1141664875 3 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664875 16:85460869-85460891 GTGAGAGTGGGCTGCAAATCAGG No data
1141664868_1141664876 26 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664876 16:85460892-85460914 ACGTGAAGTCTGATGACAGATGG No data
1141664868_1141664871 -9 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664871 16:85460857-85460879 ACCCAGGGGACCGTGAGAGTGGG No data
1141664868_1141664877 27 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data
1141664868_1141664870 -10 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664870 16:85460856-85460878 GACCCAGGGGACCGTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664868 Original CRISPR CCCCTGGGTCTGAACTGCTC TGG (reversed) Intergenic
No off target data available for this crispr