ID: 1141664871

View in Genome Browser
Species Human (GRCh38)
Location 16:85460857-85460879
Sequence ACCCAGGGGACCGTGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664868_1141664871 -9 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664871 16:85460857-85460879 ACCCAGGGGACCGTGAGAGTGGG No data
1141664865_1141664871 16 Left 1141664865 16:85460818-85460840 CCAGGGTGGGGGTGGGGAGAGTC No data
Right 1141664871 16:85460857-85460879 ACCCAGGGGACCGTGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664871 Original CRISPR ACCCAGGGGACCGTGAGAGT GGG Intergenic