ID: 1141664873

View in Genome Browser
Species Human (GRCh38)
Location 16:85460859-85460881
Sequence AGCCCACTCTCACGGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664873_1141664876 10 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664876 16:85460892-85460914 ACGTGAAGTCTGATGACAGATGG No data
1141664873_1141664877 11 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data
1141664873_1141664879 17 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG No data
1141664873_1141664881 30 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664881 16:85460912-85460934 TGGGAAAGGGCTTGGTCCAGTGG No data
1141664873_1141664880 22 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664880 16:85460904-85460926 ATGACAGATGGGAAAGGGCTTGG No data
1141664873_1141664878 16 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664878 16:85460898-85460920 AGTCTGATGACAGATGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664873 Original CRISPR AGCCCACTCTCACGGTCCCC TGG (reversed) Intergenic
No off target data available for this crispr