ID: 1141664874

View in Genome Browser
Species Human (GRCh38)
Location 16:85460867-85460889
Sequence TGATTTGCAGCCCACTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664874_1141664881 22 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664881 16:85460912-85460934 TGGGAAAGGGCTTGGTCCAGTGG No data
1141664874_1141664876 2 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664876 16:85460892-85460914 ACGTGAAGTCTGATGACAGATGG No data
1141664874_1141664882 23 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664882 16:85460913-85460935 GGGAAAGGGCTTGGTCCAGTGGG No data
1141664874_1141664880 14 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664880 16:85460904-85460926 ATGACAGATGGGAAAGGGCTTGG No data
1141664874_1141664883 24 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664883 16:85460914-85460936 GGAAAGGGCTTGGTCCAGTGGGG No data
1141664874_1141664878 8 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664878 16:85460898-85460920 AGTCTGATGACAGATGGGAAAGG No data
1141664874_1141664879 9 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG No data
1141664874_1141664877 3 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664874 Original CRISPR TGATTTGCAGCCCACTCTCA CGG (reversed) Intergenic